lentiviral packaging mix (Addgene inc)
94
Structured Review
Addgene inc
lentiviral packaging mix
Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 76 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+packaging+mix/LV-RFP+(Plasmid+%2326001)/pmc13000666-110-16-25
Average 94 stars, based on 76 article reviews
Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 76 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+packaging+mix/LV-RFP+(Plasmid+%2326001)/pmc13000666-110-16-25
Average 94 stars, based on 76 article reviews
lentiviral packaging mix - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138 Article Snippet: Preparation of Lentiviral Stocks and Transductions Third generation lentiviruses were produced in Lenti-X 293T (cat#632180, Clontech, Mountain View, Calif.) devoid of Tat in the packaging mix. .. A Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). (Sarbassov et al., 2005) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGC .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Construct:Article Title: Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138 Article Snippet: Preparation of Lentiviral Stocks and Transductions Third generation lentiviruses were produced in Lenti-X 293T (cat#632180, Clontech, Mountain View, Calif.) devoid of Tat in the packaging mix. .. A Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), Transfection:Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Article Title: Anti-Tumor Effect of Celastrol on Hepatocellular Carcinoma by the circ_SLIT3/miR-223-3p/CXCR4 Axis Article Snippet: .. To produce lentivirus for circ_SLIT3 overexpression in cells, lenti-circ_SLIT3 was transfected into HEK293T packing cells (Bnbio) together with Generated:Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), Concentration Assay:Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), shRNA:Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). (Sarbassov et al., 2005) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGC .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and CRISPR:Article Title: CEN ‐tools: an integrative platform to identify the contexts of essential genes Article Snippet: .. All gene‐specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries (Metzakopian et al , ), and lentiviruses were produced in HEK293‐FT cells using the Article Title: CEN-tools: An integrative platform to identify the ‘contexts’ of essential genes Article Snippet: .. All gene-specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries ( Metzakopian et al , 2017 ) and lentiviruses were produced in HEK293-FT cells using the Produced:Article Title: CEN ‐tools: an integrative platform to identify the contexts of essential genes Article Snippet: .. All gene‐specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries (Metzakopian et al , ), and lentiviruses were produced in HEK293‐FT cells using the Article Title: CEN-tools: An integrative platform to identify the ‘contexts’ of essential genes Article Snippet: .. All gene-specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries ( Metzakopian et al , 2017 ) and lentiviruses were produced in HEK293-FT cells using the Over Expression:Article Title: Anti-Tumor Effect of Celastrol on Hepatocellular Carcinoma by the circ_SLIT3/miR-223-3p/CXCR4 Axis Article Snippet: .. To produce lentivirus for circ_SLIT3 overexpression in cells, lenti-circ_SLIT3 was transfected into HEK293T packing cells (Bnbio) together with |