Review



lentiviral packaging mix  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc lentiviral packaging mix
    Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 76 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/LV-RFP+(Plasmid+%2326001)/pmc13000666-110-16-25
    Average 94 stars, based on 76 article reviews
    lentiviral packaging mix - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138
    Article Snippet: Preparation of Lentiviral Stocks and Transductions Third generation lentiviruses were produced in Lenti-X 293T (cat#632180, Clontech, Mountain View, Calif.) devoid of Tat in the packaging mix. .. A lentiviral packaging mix containing three plasmid constructs, pMDLg/pRRE (cat #12251), pRSV-Rev (cat #12253) and pMD2.G (cat #12259) [Addgene], was used. .. Super coiled DNA of constructs were prepared by using Qiagen maxi prep kits (cat #1045091, Germantown, Md.).

    Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas
    Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and lentiviral packaging mix (Addgene) made of three constructs: pMDLg/pRRE (#12251), pRSV-Rev (#12253), and pMD2.G (#12259). ..

    Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis
    Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). (Sarbassov et al., 2005) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGC .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Trans- fection Reagent (Roche, Hamburg, German). ..

    Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis
    Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Transfection Reagent (Roche, Hamburg, German). ..

    Construct:

    Article Title: Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138
    Article Snippet: Preparation of Lentiviral Stocks and Transductions Third generation lentiviruses were produced in Lenti-X 293T (cat#632180, Clontech, Mountain View, Calif.) devoid of Tat in the packaging mix. .. A lentiviral packaging mix containing three plasmid constructs, pMDLg/pRRE (cat #12251), pRSV-Rev (cat #12253) and pMD2.G (cat #12259) [Addgene], was used. .. Super coiled DNA of constructs were prepared by using Qiagen maxi prep kits (cat #1045091, Germantown, Md.).

    Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas
    Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and lentiviral packaging mix (Addgene) made of three constructs: pMDLg/pRRE (#12251), pRSV-Rev (#12253), and pMD2.G (#12259). ..

    Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice
    Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), lentiviral packaging mix (gag‐pol, rev), and an RFP reporter (Addgene, #26001) construct, followed by ultracentrifugation‐based concentration. ..

    Transfection:

    Article Title: C/EBPβ mediates RNA polymerase III-driven transcription of oncomiR-138 in malignant gliomas
    Article Snippet: .. To produce third-generation lentiviruses, Lenti-X 293T cells (Clontech) were transfected with maxiprep DNA constructs, prepared using Plasmid Maxi Kit (Omega bio-tek), and lentiviral packaging mix (Addgene) made of three constructs: pMDLg/pRRE (#12251), pRSV-Rev (#12253), and pMD2.G (#12259). ..

    Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis
    Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Transfection Reagent (Roche, Hamburg, German). ..

    Article Title: Anti-Tumor Effect of Celastrol on Hepatocellular Carcinoma by the circ_SLIT3/miR-223-3p/CXCR4 Axis
    Article Snippet: .. To produce lentivirus for circ_SLIT3 overexpression in cells, lenti-circ_SLIT3 was transfected into HEK293T packing cells (Bnbio) together with lentiviral packaging mix (Addgene, Cambridge, MA, USA). .. Virus particles were collected at 72 h after transfection and then used to transduce Hep3B cells in media containing 8 μg/mL of polybrene (Yesen, Shanghai, China).

    Generated:

    Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice
    Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), lentiviral packaging mix (gag‐pol, rev), and an RFP reporter (Addgene, #26001) construct, followed by ultracentrifugation‐based concentration. ..

    Concentration Assay:

    Article Title: An Ad5‐Based COVID‐19 Vaccine Encoding SARS‐CoV‐2 Spike Glycoprotein Induces Measurable Antibody and Cytokine Responses in Mice
    Article Snippet: Neutralizing antibody responses were assessed using a pseudovirus neutralization assay based on third‐generation lentiviral particles pseudotyped with SARS‐CoV‐2 Spike (Wuhan‐1 sequence; Addgene, #155130), encoding an RFP reporter gene. .. Pseudoviruses were generated in HEK293T cells by co‐transfection with plasmids encoding the Spike envelope (Addgene, #155130), lentiviral packaging mix (gag‐pol, rev), and an RFP reporter (Addgene, #26001) construct, followed by ultracentrifugation‐based concentration. ..

    shRNA:

    Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis
    Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). (Sarbassov et al., 2005) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGC .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Trans- fection Reagent (Roche, Hamburg, German). ..

    Article Title: LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis
    Article Snippet: The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864). ( ) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. .. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Transfection Reagent (Roche, Hamburg, German). ..

    CRISPR:

    Article Title: CEN ‐tools: an integrative platform to identify the contexts of essential genes
    Article Snippet: .. All gene‐specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries (Metzakopian et al , ), and lentiviruses were produced in HEK293‐FT cells using the Addgene lentiviral packaging mix. ..

    Article Title: CEN-tools: An integrative platform to identify the ‘contexts’ of essential genes
    Article Snippet: .. All gene-specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries ( Metzakopian et al , 2017 ) and lentiviruses were produced in HEK293-FT cells using the Addgene lentiviral packaging mix. ..

    Produced:

    Article Title: CEN ‐tools: an integrative platform to identify the contexts of essential genes
    Article Snippet: .. All gene‐specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries (Metzakopian et al , ), and lentiviruses were produced in HEK293‐FT cells using the Addgene lentiviral packaging mix. ..

    Article Title: CEN-tools: An integrative platform to identify the ‘contexts’ of essential genes
    Article Snippet: .. All gene-specific gRNAs were obtained from Sanger Whole Genome CRISPR Arrayed Libraries ( Metzakopian et al , 2017 ) and lentiviruses were produced in HEK293-FT cells using the Addgene lentiviral packaging mix. ..

    Over Expression:

    Article Title: Anti-Tumor Effect of Celastrol on Hepatocellular Carcinoma by the circ_SLIT3/miR-223-3p/CXCR4 Axis
    Article Snippet: .. To produce lentivirus for circ_SLIT3 overexpression in cells, lenti-circ_SLIT3 was transfected into HEK293T packing cells (Bnbio) together with lentiviral packaging mix (Addgene, Cambridge, MA, USA). .. Virus particles were collected at 72 h after transfection and then used to transduce Hep3B cells in media containing 8 μg/mL of polybrene (Yesen, Shanghai, China).



    Similar Products

    94
    Addgene inc lentiviral packaging mix
    Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/LV-RFP+(Plasmid+%2326001)/pmc13000666-110-16-25
    Average 94 stars, based on 1 article reviews
    lentiviral packaging mix - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    86
    Fisher Scientific virapower lentiviral packaging mix
    Virapower Lentiviral Packaging Mix, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/lentiviral+mix+packaging+virapower/pmc12995897-22-15-20
    Average 86 stars, based on 1 article reviews
    virapower lentiviral packaging mix - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    98
    Addgene inc lentiviral plasmid packaging mix
    Lentiviral Plasmid Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/pMD2%2EG+(Plasmid+%2312259)/bio_rxiv__64898__2026__02__17__706344-161-19-24
    Average 98 stars, based on 1 article reviews
    lentiviral plasmid packaging mix - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    86
    System Biosciences Inc lentiviral packaging mix
    Lentiviral Packaging Mix, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/hiv+kit+lentivector+packaging+ppackh1/us12553882-179-30-33
    Average 86 stars, based on 1 article reviews
    lentiviral packaging mix - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    95
    OriGene lentiviral packaging plasmid mix
    Lentiviral Packaging Plasmid Mix, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/Lentiviral+Packaging+Kits/pmc12885529-180-38-42
    Average 95 stars, based on 1 article reviews
    lentiviral packaging plasmid mix - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    98
    Addgene inc 3rd generation lentiviral packaging mix
    3rd Generation Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/pMD2%2EG+(Plasmid+%2312259)/pmc12904712-244-33-41
    Average 98 stars, based on 1 article reviews
    3rd generation lentiviral packaging mix - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    98
    Addgene inc 3rdgeneration lentiviral packaging mix
    3rdgeneration Lentiviral Packaging Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/pMD2%2EG+(Plasmid+%2312259)/pm41252211-242-33-41
    Average 98 stars, based on 1 article reviews
    3rdgeneration lentiviral packaging mix - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    86
    Obio Technology Corp Ltd transfect lentiviral packaging mix
    Transfect Lentiviral Packaging Mix, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/214+lentiviral+packaging+plasmids+pspax2/10__1016_slash_j__genrep__2025__102319-85-10-14
    Average 86 stars, based on 1 article reviews
    transfect lentiviral packaging mix - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    96
    Addgene inc third generation lentiviral packaging plasmid mix
    Third Generation Lentiviral Packaging Plasmid Mix, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+packaging+mix/pMDLg%2FpRRE+(Plasmid+%2312251)/pmc12527931-269-14-21
    Average 96 stars, based on 1 article reviews
    third generation lentiviral packaging plasmid mix - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results